Click to download Guide for Authors
Agricultural Biotechnology Journal is a peer-reviewed journal that is published in Persian (Farsi) full papers (Abstract both in Persian and English languages) by Shahid Bahonar University of Kerman and the Iranian Biotechnology Society. The general mission of the Agricultural Biotechnology Journal is to promote communication and collaboration among individuals and organizations associated with the agricultural biotechnology sector and related technologies. Papers in Agricultural Biotechnology Journal focus on discovering, disseminating, and applying knowledge for sustainable use of agricultural biotechnology. Agricultural Biotechnology Journal publishes the highest quality original contributions dealing with plant biotechnology, animal biotechnology, genetic engineering, plant and animal molecular markers, plant and animal tissue culture, and food industry biotechnology. Agricultural Biotechnology Journal is making an effort to avoid publication bias and uses plagiarism-detection software.
This Journal accepts only manuscripts through the online submission system. It is easy to use and easy to track, thus by conducting all steps electronically; your submission will be expedient. Contributors can submit via our website. Once you submit an article, it will be forwarded to one of the editors and afterwards to at least two peer-reviewers. The author will be notified of the submission process by means of e-mail.
Types of manuscripts
Research Articles. These articles usually should aim to be approximately 3000-3500 words (introduction through discussion). 30-40 references and 4-6 tables and/or figures. They require a structured abstract with a maximum of 300 words containing the following headings: Objective, Materials and Methods, Results and Conclusions.
Review articles. 4000-4500 words. The maximum number of references is 60, Maximum Number of illustrations/Tables is 6. The abstract should contain no more than 300 words and be structured with the following headings: Objective, Databases used, Conclusions.
Short communications. They should have a maximum of 2000 words. The maximum number of references is 20, Maximum Number of illustrations/Tables is 3. They require a structured abstract with a maximum of 300 words containing the following headings: Objective, Materials and Methods, Results, and Conclusions.
If you need any further help please contact the Editorial Office: jab@uk.ac.ir.
Authorship
The consent of all authors, as well as related authorities/institutions, has been received prior to the submission of the manuscript. The order of the authors (as to be reflected in the published article) has been established. The adding or deleting of authors once the manuscript has been accepted for publication would have to be accompanied by a signed statement of consent of all authors. All authors have contributed significantly to the research. Authors are obligated to participate in the peer-review process, providing retractions/ corrections/ amendments when necessary. All conflicts of interest/financial support have been declared. The order of the authors (as to be reflected in the published article) has been established.
Changes to authorship
Authors are expected to consider carefully the list and order of authors before submitting their manuscript and provide the definitive list of authors at the time of the original submission. Any addition, deletion or rearrangement of author names in the authorship list should be made only before the manuscript has been accepted and only if approved by the journal Editor. To request such a change, the Editor must receive the following from the corresponding author: (a) the reason for the change in the authors' list and (b) written confirmation (e-mail, letter) from all authors that they agree with the addition, removal or rearrangement. In the case of the addition or removal of authors, this includes confirmation from the author being added or removed.
Only in exceptional circumstances will the Editor consider the addition, deletion, or rearrangement of authors after the manuscript has been accepted. While the Editor considers the request, the publication of the manuscript will be suspended. If the manuscript has already been published in an online issue, any requests approved by the Editor will result in a corrigendum.
All authors have contributed significantly to the research. Authors are obligated to participate in the peer-review process, providing retractions/corrections/amendments when necessary. All conflicts of interest/financial support should be declared by the author, editor, or reviewer.
Declaration of interest
All authors must disclose any financial and personal relationships with other people or organizations that could inappropriately influence (bias) their work. Examples of potential conflicts of interest include employment, consultancies, stock ownership, honoraria, paid expert testimony, patent applications/registrations, and grants or other funding. If there are no conflicts of interest then please state this: 'The authors declare no conflict of interest' (if there are multiple authors) or 'The author declares no conflict of interest' if there is one author only. Please include this statement on the title page upon submission. Please declare any conflicts of interest you may have with this paper, financial or otherwise, by clicking here.
Submission declaration
Submission of an article implies that the work described has not been published previously (except in the form of an abstract, a published lecture, or academic thesis), that it is not under consideration for publication elsewhere, that its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and that, if accepted, it will not be published elsewhere in the same form, in Persian or English or in any other language, including electronically without the written consent of the copyright holder.
Copyright
Authors retain copyright to their work without restrictions. The author (s) has full control over the work (e.g. retains the right to reuse, distribute, republish, etc.). Upon acceptance of an article, the author(s) will be asked to complete a 'Journal Publishing Agreement' (see more information on this). An e-mail will be sent to the corresponding author confirming receipt of the manuscript together with a 'Journal Publishing Agreement' form or a link to the online version of this agreement. Please also submit your Letter of Commitment.
Role of the funding source
You are requested to identify who provided financial support for the conduct of the research and/or preparation of the article and to briefly describe the role of the sponsor(s), if any, in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the article for publication. If the funding source(s) had no such involvement then this should be stated. For anonymous review, this information should appear on the title page.
Open Access Policy
This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. This journal is licensed under a CC-BY-NC (Creative Commons Attribution-NonCommercial 4.0) International License.
No page charges are required from the author.
Submission
Our online submission system guides you stepwise through the process of entering your article details and uploading your files. Editable files (Word file) are required to typeset your article for final publication. All correspondence, including notification of the Editor's decision and requests for revision, is sent by e-mail. Please submit your article via http://jab.uk.ac.ir/
Double-blind review
Agricultural Biotechnology Journal uses double-blind review, which means that both the reviewer and author name(s) are not allowed to be revealed to one another for a manuscript under review. The identities of the authors are concealed from the reviewers, and vice versa. To facilitate this, please include the following separately:
1- Title page (with author details): This should include the title, authors' names, e-mails, telephone numbers and affiliations, a complete address for all authors including an e-mail address, acknowledgments (including funding), Authors' contributions, and Conflict of Interest Statement. The title must be concise and informative. Titles are often used in information-retrieval systems. Avoid abbreviations and formulae where possible.
2- Blinded manuscript (no author details): The main body of the paper (including the references, figures, and tables) should not include any identifying information, such as the authors' names or affiliations. Equipment sources should be included but may be removed for review at the Editor's discretion.
At revision, you must highlight changed words, sentences, etc with recolor and provide a separate word file entitled: “answers to Review” in which you must answer to questions and comments of all reviewers separately.
Manuscript structure
Sections in the body of the manuscript are Introduction, Materials and Methods, Results and Discussion, Conclusions, Acknowledgments, and References, respectively. Please use unnumbered sections.
Introduction
State the objectives of the work and provide an adequate background, avoiding a detailed literature survey or a summary of the results.
Material and methods
Provide sufficient detail to allow the work to be reproduced. Methods already published should be indicated by a reference: only relevant modifications should be described. Excessive recycling of words from previous manuscripts, including the methods section, will not be allowed. Specify in Materials and methods the ethical review committee approval process and the international, national, and/or institutional guidelines followed. Provide evidence in Materials and methods that the principles of reduction, refinement, and replacement have been met.
Results and Discussion
Results should be clear and concise. The discussion should explore the significance of the results of the work, not repeat them. A combined Results and Discussion section may be appropriate. Avoid extensive citations and discussion of published literature.
Conclusions
The main conclusions of the study must be presented in a short Conclusions section.
Appendices
If there is more than one appendix, they should be identified as A, B, etc. Formulae and equations in appendices should be given separate numbering: Equation (A.1), Equation (A.2), etc.; in a subsequent appendix, Equation (B.1) and so on. Similarly for tables and figures: Table A.1; Figure A.1, etc.
Acknowledgments (including sources of funding)
Authors' contributions
Conflict of interest statement
Abstract
The abstract should state briefly the purpose of the research, the principal results and major conclusions and present separately from the article. References should not be included in the abstract. Also, non-standard or uncommon abbreviations should be avoided, but if essential they must be defined at their first mention in the abstract itself. The abstract should be on a separate page and should not exceed 300 words. Objective, Materials and Methods, Results and Conclusions. For review articles, the abstract should be structured and usually should have the following headings: Objective, Databases used, and Conclusions.
Keywords: Three to five keywords or phrases should be listed immediately after the abstract.
Abbreviations: Define abbreviations at their first mention in the body of the manuscript (introduction through discussion). Ensure consistency of abbreviations throughout the article.
Please submit mathematic equations as editable text and not as images. Present simple formulae in line with normal text where possible and use the solidus (/) instead of a horizontal line for small fractional terms, e.g., X/Y.
Footnotes should rarely be used. If used, indicate the position of the footnote in the text and present the footnote separately at the bottom of each page.
Figures: Figures must be placed in the proper place of the text in the form of JPG or JPEG (.jpg). Colored figures are preferred, the font of figures should be Times New Roman, addressing figures in the text should be in regular as (Figure 1), if a figure is constructed from more than one part; each part should be presented with bold capital letters such as A), B), C), … at the top left corner and Resolution should be 300 dpi for a 3*2 inch figure. Ensure that each figure has a caption in its below. A caption should comprise a brief title (not on the figure itself) and a description of the figure. Keep text in the illustrations themselves to a minimum but explain all symbols and abbreviations used in the legend as below:
Figure 1. Electrophoresis of studied samples using beta-actin primers in Kermani sheep on the agarose gel. M50; size marker. Lanes 1-5 present adipose tissue, liver, kidney, lung, and heart, respectively. Lane 7 is the negative control
Figure 2. Melting curve of leptin and beta-actin gene production using Real-Time PCR for Kermani sheep
Tables: Please submit tables as editable text and not as images, Excel files, or embedded in Word files. Tables should be placed in the text of the manuscript in the proper place. Number tables consecutively in accordance with their appearance in the text. The caption should be placed above the table and explain the origin of the data and any table notes should be placed below the table body. Be sparing in the use of tables and ensure that the data presented in them do not duplicate results described elsewhere in the article. Please avoid using vertical rules. The style of the table should be simple and the font of the table should be Times New Roman as below:
Table 1. Oligonucleotide primer pairs used for leptin gene expression in different tissues of Kermani sheep with accession no. GU944974
|
Amplicon size (bp) |
Primer sequence |
Gene name |
|
|
199 |
5'-GCCTATGTGGGCATCCTTTA-3' |
Sense Primer |
leptin gene |
|
5'-TGGAACAGGGAGGAAGACTG -3′ |
Antisense Primer |
|
|
|
200 |
5'- ACCACTGGCATTGTCATGGACTCT -3' |
Sense Primer |
Beta actin Gene |
|
5'- TCCTTGATGTCACGGACGATTTCC -3' |
Antisense Primer |
|
|
References
Please ensure that every reference cited in the text is also present in the reference list (and vice versa). Unpublished results and personal communications are not recommended in the reference list but may be mentioned in the text.
Please use the following guidelines when formatting the reference list in your manuscript:
- Abstracts that are more than two years old should not be used as references. Avoid abstracts as references when at all possible.
- Cite the author names followed by the year of publication: (Williams et al. 2016; Mohammadabadi 2017).
- Where there are two authors they should both be included with an ampersand: (Smith & Samuel 2009).
- Where there are three or more authors, the first author's name followed by et al. should be used: (Mohammadabadi et al. 2009).
- If there is more than one reference per year from an author then distinguish with a letter: (Williams et al. 2016a) (Jones et al. 2016a,b)
- A detailed reference list should be supplied on a separate page, listed in alphabetical order of first author names.
- Journal titles should be abbreviated according to the standard forms in the National Library of Medicine, USA, database (MEDLINE or PubMed).
- Book titles should be written out in full.
- An EndNote-style download is available here.
- The following are examples of style:
Journal
Mohammadabadi MR (2017) Role of clostridium perfringens in pathogenicity of some domestic animals. J Adv Agric 7, 1117-1121.
Argraves WS, Suzuki S (1987) Amino acid sequence of the human fibronectin receptor. J Cell Biol 105, 1183-1190.
Andrade C, Sandarsh S, Chethan KB, Nagesh KS (2010) Serotonin reuptake inhibitor antidepressants and abnormal bleeding: a review for clinicians and a reconsideration of mechanisms. J Clin Psychiatry 71, 1565-1575.
Mohammadabadi MR, Askari N, Baghizadeh A, Esmailizadeh AK (2009) A directed search around caprine candidate loci provided evidence for microsatellites linkage to growth and cashmere yield in Rayini goats. Small Rumin Res 81, 146–151.
Young LE, Blissitt KJ, Clutton RE et al. (1998) Temporal effects of an infusion of dobutamine hydrochloride in horses anesthetized with halothane. Am J Vet Res 59, 1027-1032.
Campagna I, Schwarz A, Keller S et al. (2015) Comparison of the effects of propofol or alfaxalone for anaesthesia induction and maintenance on respiration in cats. Vet Anaesth
Analg 42, 484-492.
Larenza MP, Ringer SK, Kutter AP et al. (2009a) Evaluation of anesthesia recovery quality after lowdose racemic or S-ketamine infusions during anesthesia with isoflurane in horses. Am J Vet Res 70, 710-718.
Larenza MP, Peterbauer C, Landoni MF et al. (2009b) Stereoselective pharmacokinetics of ketamine and norketamine after constant rate infusion of a subanesthetic dose of racemic ketamine or Sketamine in Shetland ponies. Am J Vet Res 70, 831-839.
Book
Hall LW, Taylor PM (1994) Anaesthesia of the Cat (1st edn), Balliere Tindall, London, UK, pp. 189-193.
Pascoe PJ, Bennett RC (1999) Thoracic Surgery. In: Manual of Small Animal Anaesthesia and Analgesia (1st edn). Seymour C, Gleed R (eds). BSAVA, UK. pp. 183-196.
Abstract
Portela D, Campoy L, Otero P et al. (2015) Ultrasound-guided thoracic paravertebral injection in dog cadavers. Vet Anaesth Analg 42, A55 (abstract).
Web address
Seeler DC, Turnwald GH, Bull KS (1999) From teaching to learning:Part III. Lectures and approaches to active learning. J Vet Med Educ 21 http://scholar.lib.vt.edu/ejournals/JVME/V21-1/Seeler1.html Last accessed 1 January 2017.
Thesis
Smith GY (1978) Title of thesis. PhD thesis, University. pp. 97-112.
Scientific conference
Zamiri MJ, Heidari AH (2004) Reproductive characteristics of Rayini male goats in Kerman province of Iran. Proc. of 11th Congress of the Asian-Australasian Association of Animal Production Societies. Volume II, Sept. 5-9, 2004. Kuala Lumpur, Malaysia. pp. 458-460,
Journal names should be abbreviated according to the List of Title Word Abbreviations.
Please submit your Letter of Commitment