Agricultural Biotechnology Journal

Agricultural Biotechnology Journal

Study of the effect of Hd1-harboring genomic region on heading date in rice

Document Type : Research Paper

Authors
Abstract
Transition from vegetative to reproductive stage in rice plays a vital role in regulation of timing of flowering and is one of its adaptation related traits to different cultivation areas or different cropping seasons. Several genes related to heading date were identified in rice, that Hd1 on the 6th rice chromosome is one of the most important ones. In this study, two rice cultivars including Sadri (as early flowering donor parent) and Neda (as late flowering recipient parent) were crossed to investigate the effect of Hd1-harboring genomic region on rice heading date, and BC2 generation was developed with two times of backcrossing. Then a single heterozygote plant in BC2 generation was self-pollinated to obtain BC2F2 population for conducting phenotypic and molecular studies. The studied population had a continuous phenotypic distribution in heading date and some individuals in the population showed transgressive segregation over late flowering parent. On the basis of an InDel region in first exon of Hd1 gene a functional specific marker was designed which produced a distinct different banding pattern among the cross parents. Hence, this marker was used to evaluate allelic pattern of Hd1 in BC2F2 population. Analysis of allelic segregation revealed that Hd1 locus in the studied population followed from the expected Mendelian segregation (with 1:2:1 ratios). Composite interval mapping (CIM) with microsatellite markers showed that genomic region at Hd1-RM527 interval had a high relationship (LOD>7.5) to heading date and explained nearly 28 percent of phenotypic variation of the trait. Additive effect of the donor parent allele on the trait was negative and was estimated nearly -3.4 days. Results of this investigation indicated that Hd1 had a significant effect on heading date in rice and it is possible to use the newly developed functional marker in this research for tracing the Hd1 in segregating populations and marker-assisted selection (MAS) for early maturity
Keywords

مطالعه اثر ناحیه ژنومی حامل ژن Hd1 بر زمان خوشه­دهی در برنج

اسدالله احمدی­خواه1*، لیلا نیری­پسند2

1 عضو هیات علمی، گروه زیست­فناوری، دانشکده مهندسی انرژی و فناوری­های نوین، دانشگاه شهید بهشتی تهران.

2 دانش آموخته کارشناسی ارشد، گروه زراعت و اصلاح نباتات، دانشکده علوم زراعی، دانشگاه علوم کشاورزی و منابع طبیعی ساری.

تاریخ دریافت: 01/12/1391، تاریخ پذیرش: 20/07/1392

چکیده

عبور از مرحله رویشی به مرحله زایشی موجب تنظیم زمان خوشه­دهی در برنج می­گردد که از صفات مرتبط با سازگاری این گیاه به نواحی کاشت مختلف یا فصول متفاوت، می­باشد. چندین ژن مرتبط با زمان خوشه­دهی در برنج شناسایی شده است که یکی از مهمترین آنها ژن Hd1 بر روی کروموزوم شماره 6 برنج می­باشد. در این مطالعه دو رقم برنج شامل ارقام صدری (به عنوان والد بخشنده زودرس) و ندا (به عنوان والد دوره­ای دیر­رس)، به منظور بررسی اثر ناحیه ژنومی حامل ژن Hd1 بر زمان خوشه­دهی در برنج، تلاقی داده شدند و با دو بار تلاقی برگشتی نسل BC2 ایجاد گردید. سپس یک بوته هتروزیگوت از نسل BC2 خودگشن گردید تا جمعیت BC2F2 جهت انجام مطالعات فنوتیپی و مولکولی به دست آید. جمعیت مورد مطالعه از نظر زمان خوشه­دهی دارای توزیع فنوتیپی پیوسته بوده و برخی افراد جمعیت تفکیک متجاوز نسبت به والد دیررس نشان دادند. بر اساس ناحیه InDel موجود در اگزون شماره یک ژن Hd1 یک نشانگر کارکردی اختصاصی طراحی شد که تفاوت باندی واضحی بین والدین تلاقی ایجاد نمود. از اینرو، این نشانگر جهت ارزیابی الگوی آللی Hd1 در جمعیت BC2F2 استفاده گردید. بررسی نحوه تفکیک آللی نشان داد که مکان ژنی Hd1 در جمعیت مورد مطالعه از الگوی تفرق مورد انتظار مندلی (با نسبت 1:2:1) پیروی نمود. نقشه­یابی فاصله­ای مرکب (CIM) با نشانگرهای ریزماهواره نشان داد که ناحیه ژنومی در حد فاصل نشانگرهای Hd1-RM527 ارتباط زیادی (5/7<LOD) با زمان خوشه­دهی داشت و حدود 28 درصد از تغییرات فنوتیپی را توجیه نمود. اثر افزایشی آلل والد بخشنده، منفی و در حدود 4/3- روز برآورد گردید. نتایج این بررسی بیانگر اثر معنی­دار ژن Hd1 بر زمان خوشه­دهی در برنج می­باشد و از نشانگر کارکردی توسعه یافته در این تحقیق می­توان برای ردیابی ژن Hd1 در جمعیت­های در حال تفرق و گزینش به کمک نشانگر (MAS) برای زودرسی استفاده کرد.

کلمات کلیدی: زودرسی، نشانگر کارکردی، نقشه­یابی.



مقدمه

زمان گلدهی یا تاریخ خوشه­دهی عامل مهمی نه تنها از حیث کمّیت محصول، بلکه از نظر کیفیت دانه در برنج به شمار می­رود (Fan et al., 2005). از طرفی عبور از مرحله رویشی به مرحله زایشی جهت تکثیر جنسی موفق گیاهان از اهمیت به سزایی برخوردار می­باشد که به وسیله عوامل داخلی و بیرونی تنظیم می­گردد (Kojima et al., 2002). در برنج، روزهای کوتاه موجب تحریک و القای انتقال به مرحله گلدهی می­شود. در اغلب واریته­های برنج دوره رشد رویشی متغیر است در حالی که دوره رشد زایشی نسبتاً پایدار می­باشد. بنابراین زمان خوشه­دهی (روز از کاشت تا خوشه­دهی) عموماً بیانگر دوره رشد می­باشد. حساسیت به فتوپریود، حساسیت به دما و دوره رشد رویشی تعیین­کننده زمان خوشه­دهی در برنج هستند (You-long et al., 2009). مطالعات پیشین نشان داده اند که چندین ژن در پاسخ به فتوپریود در برنج نقش دارند (Yokoo et al., 1980؛ Sano, 1992؛Tsai, 1995; ؛ Lu et al., 1997؛Lin et al., 1998؛ Maheswaran et al., 2000 ؛ Yu et al., 2002؛ Brondani et al., 2002؛ Zhou et al., 2001؛ Hittalmani et al., 2002؛ Rabiei, 2007). تعداد زیادی مکان صفت کمّی (QTL) مرتبط با زمان خوشه­دهی در برنج شناسایی شده­اند. در مطالعه­ای، Lin et al (2000) با استفاده از لاین­های ایزوژن نزدیک (NIL) نشان دادند که سه ژن Hd1، Hd2 و Hd3 در بروز حساسیت به فتوپریود دخالت دارند. اخیراً نشان داده شد که QTLهای معینی به طور مستقیم موجب اثرات متقابل پیچیده برای زمان خوشه­دهی و یا پاسخ به فتوپریود می­شوند (Ordonez et al., 2010). برای مثال، یک QTL بزرگ اثر بر روی بازوی کوتاه کروموزوم 6 (با نماد Hd1) باعث القای گلدهی در شرایط روزکوتاه و ممانعت از گلدهی در شرایط روز بلند می­گردد (Yano et al., 2000). مشخص گردیده که Hd1 در شرایط روز کوتاه باعث تنظیم عمل QTL بزرگ­اثر دیگری موسوم به Hd3a واقع بر کروموزوم 6 می­شود (Kojima et al., 2002). RFT1 مشابه Hd3a توسط Hd1 در روزهای کوتاه تنظیم می­شود و بیان آن در طی روز اتفاق افتاده و در غروب به اوج می­رسد (Komiya et al., 2008). همچنین، Yano et al (1997) نیز نشان دادند که Hd1 اثر زیادی بر روی تاریخ خوشه­دهی دارد. شبکه ژنی که گل­دهی را تحت پوشش قرار می­دهد شامل گیرنده­های نوری، اجزای مولکولی دخیل در تنظیم ساعت بیولوژیک و ژن­های ایجادکننده گل­دهی می­باشند (Kojima et al., 2002; Yano et al., 2000). مطالعات ژنتیک مولکولی نشان می­دهد ژن­های ارتولوگ[1] (شامل Hd1/CO و Hd3a/FT) در برنج به عنوان یک گیاه روز کوتاه و آرابیدوپسیس به عنوان یک گیاه روز بلند، در گل­دهی فتوپریودی برنج نقش دارند. ژن Ehd1 گل­دهی را در شرایط روزکوتاهی در حضور آلل عملکردی Hd1 سرعت می­بخشد (Tsuji et al., 2008). ژن Hd1 از دو اگزون و یک اینترون ساخته شده که پروتئینی با 395 اسید آمینه را رمز می­کند و جزو خانواده ژنی CO (آرابیدوپسیس) با یک ناحیه زینک فینگر[2] می­باشد (Yano et al., 2000). به نظر می­رسد که Hd1 به واسطه داشتن همین ناحیه، بر رونویسی ژن­هایی که بیان آنها به وسیله تغییر در فتوپریود کنترل می­شود، تأثیر می­گذارد (Yano et al., 2000).

در دو دهه گذشته،‌ امکان انتقال نواحی ژنومی مورد نظر با استفاده از نشانگرهای مولکولی فراهم شده است که منتج به طراحی و اجرای تعداد زیادی آزمایشات نقشه­یابی ژنتیکی با هدف توسعه نشانگرهای مولکولی قابل کاربرد در گزینش به کمک نشانگر[3] (MAS) و یا به طور خاص،‌ قابل کاربرد در برنامه تلاقی برگشتی به کمک نشانگر[4] (MABC) شده است (Semgan et al., 2006). استراتژی MAS مبتنی بر عدم تعادل لینکاژ بین نشانگر و QTLها می­باشد و در صورت وجود آن،‌ گزینش به کمک نشانگر ساده،‌ سریع،‌ ارزان و بسیار مؤثرتر از روش گزینش فنوتیپی می­باشد (Hospital, 2009). روش تلاقی برگشتی به کمک نشانگر برای گزینش پس­زمینه[5] و تسریع در بازیابی ژنوم والد دوره­ای[6] به کار می­رود (Hospital et al., 1992؛ Wang et al., 2007). در همین راستا نشانگرهای مولکولی شناسایی شده­اند که با خصوصیات مهم زراعی- اقتصادی پیوستگی داشته و از آن­ها در برنامه MABC در چندین گونه گیاهی نظیر ذرت،‌ برنج،‌ گندم و جو استفاده شده است (Semgan et al., 2006). هدف از اجرای این تحقیق، شناسایی فرم­های آللی مختلف ژن Hd1 در برنج و مشخص نمودن اثرات ژنتیکی آن­ها در تغییرات فنوتیپی صفت تعداد روز تا خوشه دهی در برنج می­باشد تا بتوان از آن در برنامه­های گزینش به کمک نشانگر برای زودرسی استفاده نمود.

 

مواد و روش­ها

مواد گیاهی

در این تحقیق از دو رقم والدینی ایرانی ندا و صدری استفاده شد. رقم ندا از ارقام اصلاح شده الیت منطقه شمال کشور با عملکرد بالا و میان­رس می­باشد، در حالی که رقم صدری از ارقام محلی کیفی با عملکرد متوسط و زودرس به حساب می­آید. این دو رقم در سال 1386 در شرایط آب و هوایی گرگان در دانشگاه علوم کشاورزی و منابع طبیعی گرگان تلاقی داده شدند و در سال 1388 جمعیت نسل اول تلاقی برگشتی (BC1) از تلاقی رقم ندا به عنوان والد دوره­ای با گیاهان F1 و در سال 1389 جمعیت نسل دوم تلاقی برگشتی (BC2) از تلاقی رقم ندا با گیاهان BC1 ایجاد شد. پس از انگشت­نگاری گیاهان BC2 با نشانگر اختصاصی ژن Hd1 یک بوته هتروزیگوت شناسایی گردید و در پاییز همان سال در اهواز از خودگشنی این بوته BC2، جمعیت نسل BC2F2 به دست آمد. جهت ارزیابی فنوتیپی زمان خوشه­دهی، در سال 1390 تعداد 118 بوته از جمعیت نسل BC2F2 در مزرعه مستقر گردید. فاصله بوته­ها 25×25 سانتی­متر در نظر گرفته شد. در مورد والدین تلاقی، از هر کدام 20 بوته در دو ردیف کشت گردید. زمان خوشه­دهی بوته­های BC2F2 به همراه والدین به صورت تعداد روز از زمان بذرپاشی تا زمان خروج اولین خوشه در هر بوته یادداشت گردید.

 

تهیه نمونه برگی، استخراج DNA و واکنش زنجیره­ای پلی­مراز

نمونه­گیری از برگ­های جوان هر بوته در مزرعه انجام شد و نمونه­های برگی پس از برچسب­زنی در داخل کیسه فریزر بر روی یخ به آزمایشگاه منتقل گردید. استخراج دی ان ای از برگ­های جوان هر بوته به روش CTAB با اندکی تغییرات (Ahmadikhah, 2009) انجام شد. کیفیت DNA به وسیله الکتروفورز با استفاده از ژل آگارز یک درصد تعیین شد. کمّیت DNA با استفاده از دستگاه اسپکتروفتومتر در طول موج 260 نانومتر اندازه­گیری شد و غلظت هر نمونه در حد 100 نانوگرم بر میکرولیتر تنظیم گردید. سپس نمونه­ها تا زمان استفاده در واکنش PCR در فریزر 20- ذخیره شدند. برای تهیه مخلوط واکنش­های PCR از کیت شرکت سیناکلون (PCR master mix kit) استفاده شد. مواد مورد استفاده در یک واکنش PCR شامل 6 میکرولیتر PCR Master Mix، 1 میکرولیتر از هر کدام از آغازگرهای مستقیم و معکوس (10 نانو مولار)، 8/4 میکرولیتر  آب دوبار تقطیر بود که پس از تقسیط به هر تیوب، 1 میکرولیتر DNA الگو (10 نانوگرم) اضافه گردید. واکنش­های تکثیر در دستگاه ترمال سایکلر شرکت PeqLab و با چرخه­های دمایی شامل ºC94 به مدت 5 دقیقه؛ 35 چرخه در ºC94 به مدت 30 ثانیه، ºC35 به مدت 45 ثانیه، ºC72 به مدت 90 ثانیه؛ و سرانجام ºC72 به مدت 7 دقیقه انجام گردید. پس از تکثیر، فرآورده­های PCR بر روی ژل آگارز 5/2 درصد با ولتاژ 110 ولت الکتروفورز گردید. پس از پایان الکتروفورز عکس برداری از ژل­ها با دستگاه UV trans-illuminator انجام شد.

 

تجزیه­ و تحلیل داده­ها

داده های فنوتیپی

مقادیر آماره­های مختلف از قبیل میانگین، انحراف معیار (SD)، خطای معیار (S.E.)، حداقل و حداکثر به همراه شاخص­های شکل نوزیع داده­ها شامل چولگی و کشیدگی با استفاده از نرم افزارver. 11  SPSS (Kinnear & Colin, 2000) محاسبه گردید. به منظور آزمون برازش مقادیر مشاهده شده با مقادیر مورد انتظار، از آزمون مربع کای استفاده شد.

 

داده های­مولکولی

طراحی آغازگرهای مورد نیاز برای واکنش زنجیره ای پلیمراز با نرم­افزاز Primer3.0 (frodo.wi.mit.edu) انجام شد. انتخاب آغازگرهای اختصاصی ژن Hd1 به شرحی که در نتایج آمده است انجام گرفت. سه جفت آغازگر ریزماهواره در اطراف ژن Hd1 جهت آشکارسازی چندشکلی بین والدین تلاقی به کار رفت (جدول 1). جهت تعیین ارتباط مکان ژن Hd1 با صفت مورد مطالعه، از روش نقشه­یابی فاصله­ای مرکب (CIM) در نرم­افزار QTL Cartographer 2.5 (Wang et al., 2005) استفاده شد.

 

 

جدول 1- آغازگرهای ریزماهواره مورد استفاده در این تحقیق.

Table 1- Microsatellite primes used in the study.

نام آغازگر

Primer name

توالی (`3-`5)

Sequence (5`-3`)

دمای ذوب

(oC)

Tm (oC)

اندازه باند (جفت باز) بر اساس توالی رقم نیپون­بار

Band size (bp) with reference to Nipponbare

RM19744-F

CTAGACCAGATTGTGGATGAACG

55.3

192

RM19744-R

GAAGTGGAAGAGATCCGCTAGG

56.7

RM527-F

CGGTTTGTACGTAAGTAGCATCAGG

57.7

106

RM527-R

TCCAATGCCAACAGCTATACTCG

55.3

RM19930-F

CTATCGGATGATCCACTGTCAGG

57.1

163

RM19930-R

TAGAGGCCAGGGATGATGTCG

56.3

 

 

آستانه معنی­داری (LOD) با انجام آزمون جایگشت[7] (با 500 تکرار) تعیین گردید. برآورد پارامترهایی مانند اثر افزایشی، اثر غالبیت، سهم ژن در توجیه تغییرات فنوتیپی (R2) و رسم گراف مربوطه در محیط این نرم­افزار انجام شد.

 

 

 

نتایج

بررسی­های فنوتیپی

والد بخشنده (صدری) و دوره­ای (ندا) دارای زمان خوشه­دهی بسیار متفاوتی (به ترتیب 85 و 103 روز) بودند، در حالیکه حداقل و حداکثر زمان خوشه­دهی جمعیت BC2F2، به ترتیب 90 و 106 روز به دست آمد و برخی بوته­های جمعیت BC2F2 تفکیک متجاوز نسبت به والد دیررس­تر (ندا) نشان دادند که این می­تواند دلیلی بر کمّی بودن صفت مورد مطالعه باشد. در این مطالعه جمعیت در حال تفرق تهیه شده دارای توزیع فنوتیپی پیوسته و نرمال بوده و از این­رو جهت مطالعات بعدی مناسب تشخیص داده شد (جدول 2؛ شکل 1).

 

تجزیه­های بیوانفورماتیک و انتخاب آغازگرهای اختصاصی ژن Hd1

اکسشن­های مربوط به ژن Hd1 از وبگاه NCBI (www.ncbi.nlim.nih.gov) (شامل 23 اکسشن از AB474759.1 تا AB474781.1) دانلود گردید و برای مقایسه و همردیف کردن آنها از نرم­افزار Bioedit2007 استفاده شد. نتیجه همردیف­سازی توالی­های نوکلئوتیدی نشان داد که علاوه بر جایگزینی­های متعدد در موقعیت­های مختلف، یک ناحیه بزرگ InDel (حذف/اضافه) در اگزون اول این ژن بین اکسشن­های مختلف وجود دارد. این InDel دارای سه فرم آللی متفاوت است (شکل 2). فرم اول (A) فاقد اضافه شدگی، فرم دوم (B) دارای یک اضافه شدگی به اندازه 36 نوکلئوتید و فرم سوم (C) دارای یک اضافه شدگی به اندازه 152 نوکلئوتید بود. بنابراین امکان طراحی آغازگرهایی در دو طرف این ناحیه InDel برای آشکارسازی پلی­مورفیسم وجود داشت.

 (آغازگر مستقیم: 5`-ACAACAACAACAACAATAACAAC-3`؛ آغازگر معکوس: 5`-TGTTCATGCATCCCATACTG-3`).

با توجه به موقعیت آغازگرهای طراحی شده (شکل 2) اندازه باند مربوط به فرم­های آللی مختلف به ترتیب معادل 303، 187 و 151 جفت باز پیش­بینی گردید. بنابراین می­توان انتظار داشت که بتوان سه فرم آللی فوق را بر روی ژل آگارز به راحتی از همدیگر جدا نمود.

 

 

 


جدول 2- پارامترهای مرتبط با زمان خوشه­دهی والدین تلاقی و جمعیت BC2F2.

Table 2- heading date related parameters in parents of the cross and BC2F2 population.

ردیف

Row

پارامتر

Parameter

مقدار

Quantity

انحراف معیار (خطای معیار)*

SD(SE)*

1

میانگین رقم صدری (والد بخشنده)

85

1.1

2

میانگین رقم ندا (والد دوره­ای)

103

0.8

3

میانگین جمعیت BC2F2 (روز)

98.64

3.53

4

چولگی

-0.015

0.223

5

کشیدگی

-0.520

0.442

6

حداقل

90

-

7

حداکثر

106

-

* در مورد پارامترهای ردیف 1 تا 3 انحراف معیار و در مورد پارامترهای ردیف 4 و 5 خطای معیار منظور گردید.

* SD was considered in the case of rows 1-3 and SE was considered in the case of rows 4 and 5.

 

 

شکل 1- توزیع فنوتیپی زمان خوشه­دهی در جمعیت BC2F2. موقعیت والدین با پیکان نشان داده شده است.

Figure 1- Phenotypic distribution of heading date in BC2F2 population. Position of parents was shown with arrowheads.

 



مطالعه جمعیت BC2F2 با نشانگر کارکردی ژن Hd1

تکثیر DNA والد دوره­ای ندا و بخشنده صدری با نشانگر طراحی شده بر اساس InDel موجود در اگزون اول ژن Hd1 نشان دهنده تفاوت باندی واضحی بین دو والد بود (شکل 3). رقم ندا دارای اندازه باند 187 جفت باز و رقم صدری دارای اندازه باند 151 جفت باز طبق انتظار بود. بنابراین جهت مشاهده تفکیک آللی در این مکان InDel، انگشت نگاری 118 بوته از جمعیت BC2F2 با نشانگر اختصاصی انجام شد که نتایج حاکی از تفرق مندلی در این مکان ژنی بود (جدول 3). همانگونه که ملاحظه می­شود، 27 بوته (9/22 درصد) دارای آلل والد بخشنده، 35 بوته (7/29 درصد) دارای آلل والد دوره­ای و 56 بوته (5/47 درصد) دارای آلل­های هر دو والد می­باشند. میانگین زمان خوشه­دهی بوته­های هموزیگوس مغلوب 3/102 روز و میانگین زمان خوشه­دهی بوته­های هموزیگوس غالب 5/95 روز برآورد گردید.

 


بررسی اثر ژن Hd1 با روش نقشه­یابی فاصله­ای مرکب

جهت بررسی اثر ژن Hd1 بر زمان خوشه­دهی از مکان­یابی QTL با روش نقشه­یابی فاصله­ای مرکب (CIM) استفاده شد. به این منظور چندین نشانگر ریزماهواره در اطراف مکان ژنی Hd1 انتخاب و جهت آشکارسازی چندشکلی بین والدین تلاقی به کار رفتند که سه نشانگر ریزماهواره (شامل RM19744، RM527 و RM19930) در دو طرف ژن Hd1 بین والدین تلاقی چندشکلی نشان دادند. پس از انگشت­نگاری کل جمعیت نقشه­یابی با این نشانگرها به همراه نشانگر مبتنی بر InDel موجود در ژن Hd1 و انجام تجزیه با روش نقشه­یابی فاصله­ای مرکب (CIM) مشخص شد که ناحیه­ ژنومی در حد فاصل Hd1-RM527 با زمان خوشه­دهی در ارتباط می­باشد (5/7LOD>). این مکان ژنی حدود 28 درصد از تغییرات فنوتیپی صفت زمان خوشه­دهی را توجیه نمود. اثر افزایشی آلل صدری بر زمان خوشه­دهی منفی و معادل 4/3- روز برآورد گردید، در حالیکه اثر غالبیت مثبت ولی ناچیز بوده است (شکل 4).

 



 

شکل 2- طرحی از ساختار ژن Hd1 و سه فرم آللی در اگزون شماره یک آن: فرم A فاقد اضافه شدگی، فرم B دارای اضافه شدگی 36 نوکلئوتیدی و فرم C دارای اضافه شدگی 152 نوکلئوتیدی. موقعیت آغازگرهای PCR بر اساس اکسشن مرجع (AB474759.1) می­باشد و محل آنها با پیکان نشان داده شده است.

Figure 2- A scheme of Hd1 structure and three allelic forms in its first exon: form A absents insertion, form B has a 36 n.t insertion and form C has a 152 n.t insertion. Positions of PCR primers are shown with the reference to AB474759.1 accession (Nipponbare) and arrowheads show their location.

 

 

 

شکل 3- نمونه­ای از الگوی الکتروفورزی محصول تکثیر PCR با نشانگر مبتنی بر InDel در اگزون شماره یک ژن Hd1 بر روی ژل آگارز 5/2 درصد. والدین تلاقی شامل ندا (N) و صدری (S) و تعدادی از افراد نسل BC2F2 نشان داده شده­اند. M: نشانگر اندازه مولکولی 100 جفت باز.

Figure 3- A sample of electrophoretic pattern of PCR products obtained with InDel- based marker in first exon of Hd1 on 2.5% agarose gel. Parents of the cross included Neda (N) and Sadri (S) and some of BC2F2 individuals are shown. M: 100 bp size marker.

 


جدول 3- میانگین زمان خوشه­دهی، فراوانی ژنوتیپی و آزمون تفکیک مندلی.

Table 3- Average of heading date, genotypic frequencies and Mendelian segregation test.

ژنوتیپ

Genotype

زمان خوشه­دهی (روز)

Heading date(days)

فراوانی

Frequency

فراوانی مورد انتظار

(1:2:1)

Expected frequency (1:2:1)

2χ

hd1hd1

102.3

27

29.5

0.21

Hd1hd1

98.7

56

59.0

0.15

Hd1Hd1

95.5

35

29.5

1.03

جمع

 

118

118

1.39 n.s

n.s- غیر معنی­دار [با توجه به 82/7= (df=2;α=5%)2χ]                                    n.s- non-significant [χ2(df=2, α=0.05)=7.82]

 


 

 

R2

درجه غالبیت (d)

Dominance degree

اثرغالبیت

Dominance effect

اثر افزایشی

Additive effect

LOD

موقعیت

Position

فاصله نشانگری

Marker interval

0.278

-0.055

0.185

-3.38

7.75

8

Hd1-RM527

شکل 4- نقشه­یابی فاصله­ای مرکب (CIM) برای صفت روز تا خوشه­دهی در برنج.

Figure 4- Composite interval mapping (CIM) analysis for heading date in rice.

 



بحث

در این تحقیق جهت بررسی اثر ژن Hd1 بر زمان خوشه­دهی در برنج ابتدا یک جمعیت BC2F2 از تلاقی بین ارقام ایرانی صدری و ندا با روش تلاقی برگشتی ایجاد گردید و بررسی­های فنوتیپی در شرایط مزرعه و مطالعات مولکولی به همراه والدین تلاقی صورت گرفت. از آنجا که نتاج خودگشن شده تلاقی برگشتی قابلیت تکرار دارند، نسبت به تک گیاهان والدینی‌ خود، از خطای محیطی کمتری برخوردار هستند. بنابراین استفاده از آن‌ها برای شناسایی QTLهای با وراثت‌پذیری پایین مناسب‌تر است (Ahmadikhah, 2011). نتایج نشان داد که آغازگرهای مبتنی بر ناحیه InDel در اگزون شماره 1 ژن Hd1 توانستند به طور اختصاصی منطقه هدف را تکثیر نموده و چندشکلی بین والدین تلاقی را آشکار نمایند. بنابراین نشانگر توسعه یافته را می­توان یک نشانگر تکثیر آلل اختصاصی[8] (ASA) کارکردی تلقی کرد. مطالعات زیادی در گذشته با استفاده از چنین نشانگرهایی هم در جانوران و هم در گیاهان جهت اهداف خاص توسعه یافته است (Soleimani et al., 2003؛ Liu and Sommer, 2004؛ LaFramboise et al., 2005؛ Ahmadikhah et al., 2010؛ Ahmadikhah and Irannejad, 2010; Kiani, 2011;؛ Gaafar, 2010؛ Hirotsu et al., 2010؛ Nayyeripasand et al., 2013). با توجه به اتمام پروژه تعیین توالی ژنوم برنج (Goff et al., 2002) و همچنین با ثبت شکل­های آللی جدید از ژن­های مختلف در بانک ژن جهانی در سراسر دنیا (www.ncbi.nlm.nih.gov)، استفاده از نشانگرهای ASA تبدیل به ابزار مفیدی جهت تجزیه فراوانی­های آللی ژن­های کاندید و بررسی اثر آنها بر تغییرات فنوتیپی صفات مورد مطالعه و همچنین استفاده از آنها در مطالعات ارتباط[9] شده است (Nayyeripasand et al., 2013). نتایج این تحقیق نشان داد که انتقال ژن Hd1 از طریق تلاقی برگشتی به زمینه ژنتیکی رقم ندا (از ارقام الیت منطقه شمال کشور) می­تواند زمان خوشه­دهی را تسریع نماید، به طوری که در نسل BC2F2 تفاوت زمان خوشه­دهی بوته­های دارای ژنوتیپ Hd1Hd1 با زمان خوشه­دهی بوته­های دارای ژنوتیپ مغلوب معادل 8/6 روز است.  نتایج نقشه­یابی فاصله­ای مرکب (CIM) با استفاده از نشانگرهای ریزماهواره تأیید نمود که ژن Hd1 ارتباط معنی­داری (5/7LOD>) با زمان خوشه­دهی در برنج دارد (شکل 4) و آلل کاهنده از والد بخشنده دارای اثر افزایشی منفی معادل 4/3- روز بود که این نتیجه با نتایج سایر تحقیقات مبنی بر دخالت آلل غیر کارکردی Hd1 در تسریع زمان خوشه­دهی در برنج مطابقت دارد (Hayama et al., 2003; Gaafar, 2010؛ Kim et al., 2007)؛ در حالی که در گیاه آرابیدوپسیس روزهای بلند سبب بیان ژن CO در غروب می­شود و لذا پروتئین مربوطه سبب زودرسی در شرایط روزبلندی می­شود. بنابراین می­توان بیان نمود که تنظیم ژن­های گروه FT توسط ژن­های CO (در آرابیدوپسیس) و Hd1 (در برنج) به ترتیب نقش مرکزی در فتوپریودیسم گیاهان روزبلند و روزکوتاه دارد (Doi et al., 2004). همانگونه که در بالا ذکر شد، به کمک نشانگر کارکردی اختصاصی Hd1، آلل کاهنده زمان خوشه­دهی در والد بخشنده صدری شناسایی گردید. شناخت آلل کاهنده زمان خوشه­دهی می­تواند اهمیت اصلاحی داشته باشد، زیرا هنگامی که بهنژادگر قصد بهبود و اصلاح لاین­های زودرس از طریق استراتژی گزینش به کمک نشانگر (MAS) را دارد، دانستن اینکه کدام آلل موجب زودرسی می­شود، انتخاب والد بخشنده­ای که باید با لاین(های) گیرنده تلاقی یابد را تسهیل می­نماید. نتایج نقشه­یابی فاصله­ای مرکب همچنین نشان داد که ژن Hd1 حدود 28 درصد از تغییرات فنوتیپی صفت زمان خوشه­دهی را در جمعیت BC2F2 تبیین کرد. در مطالعات پیشین نیز نشان داده شد که این ژن بسته به نوع جمعیت نقشه­یابی به کار رفته بین 18 تا 31 درصد از تغییرات فنوتیپی زمان خوشه­دهی را در برنج توجیه می نماید (Park et al., 1995؛ Yamamoto et al., 1998؛ Lin et al., 2000؛ Yano et al., 1997).

نتیجه گیری

ژن Hd1 تاثیر معنی­داری بر زمان خوشه­دهی در برنج دارد و نشانگر کارکردی اختصاصی ژن Hd1 که بر اساس یک ناحیه InDel بزرگ در اگزون شماره 1 ژن مزبور طراحی شد، می­تواند به طور موثری در گزینش به کمک نشانگر برای اصلاح ارقام زودرس در برنج به کار رود.


 

منابع

Ahmadikhah A (2009). A rapid mini-prep DNA extraction method in rice. African Journal of Biotechnology 8: 234-238.

Ahmadikhah A (2011). Advanced plant breeding. Gorgan University Press, Goragan, Iran. 480 pp.

Ahmadikhah A, Arkhy A, Ghafari H (2010). Development of an allele specific amplification (ASA) co-dominant marker for fragrance genotyping of rice cultivars. Archives of Applied Science Research 2: 204-211.

Ahmadikhah A, Irannejad A (2010). Development of a co-dominant CMS-specific ALP marker in Tobacco (Nicotiana tabacum). Annals of. Biological Research 1: 101-106.

Brondani C, Rangel PHN, Brondani RPV, Ferreira ME (2002). QTL mapping and introgression of yield–related traits from Oryza glumaepatula to cultivated rice (Oryza sativa) using microsatellite markers. Theoretical and Applied Genetics 104: 1192–1203.

Doi K, Izawa T, Fuse T, Yamanouchi U, Kubo T, Shimatani Z, Yano M, Yoshimura A (2004). Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes and Development 18: 926-936.

Fan CC, Yu XQ, Xing YZ, Xu CG, Luo LJ, Zhang Q (2005). The main effects, epistatic effects and environmental interactions of QTLs on the cooking and eating quality of rice in a doubled-haploid population. Theoretical and Applied Genetics 110: 1445-1452.

Gaafar RM (2010). Molecular marker analysis of heading date Hd1 locus in Egyptian rice varieties. Biotechnology 23: 3368-3372.

Goff SA, Ricke D, Lan TH, Presting G, Wang RL, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, Hadley D, Hutchinson D, Martin C, Katagiri F, Lange BM, Moughamer T, Xia Y, Budworth P, Zhong JP, Miguel T, Paszkowski U, Zhang SP, Colbert M, Sun WL, Chen LL, Cooper B, Park S, Wood TC, Mao L, Quail P, Wing R, Dean R, Yu YS, Zharkikh A, Shen R, Sahasrabudhe S, Thomas A, Cannings R, Gutin A, Pruss D, Reid J, Tavtigian S, Mitchell J, Eldredge G, Scholl T, Miller RM, Bhatnagar S, Adey N, Rubano T, Tusneem N, Robinson R, Feldhaus J, Macalma T, Oliphant A, Briggs S (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. Japonica). Science 296: 92-100.

Hirotsu N, Murakami N, Kashiwagi T, Ujiie K, Ishimaru K (2010). A simple gel-free method for SNP genotyping using allele-specific primers in rice and other plant species. Plant Methods 6: 12-16.

Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003). Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 422: 719-722.

Hittalmani S, Shashidhar HE, Bagali PG, Huang N, Sidhu JS, Singh VP, Khush GS (2002). Molecular mapping of quantitative trait loci for plant growth, yield and yield related traits across three diverse locations in a doubled haploid rice population. Euphytica 125: 207–214.

Hospital F, Chevalet C, Mulsant P (1992). Using Markers in Gene Introgression Breeding Programs. Genetics 132: 1199-1210.

Hospital F (2009). Challenges for effective marker-assisted selection in plants. Genetica 136: 303–310.

Kiani Gh (2011). Marker aided selection for aroma in F2 populations of rice. African Journal of Biotechnology 10: 15845-15848.

Kim SL, Lee S, Kim HJ, Nam HG, An G (2007). OsMADS51 is a shortday flowering promoter that functions upstream of Ehd1, OsMADS14, and Hd3a. Plant Physiology 145: 1484-1494.

Kinnear PR, Colin DG (2000). SPSS for Windows made simple: Release 10. Hove, UK: Psychology Press.

Kojima S, Takahashi Y, Kobayashi Y, Monna L, Sasaki T, Araki T, Yano M (2002). Hd3a, a rice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions. Plant Cell Physiology 43: 1096-1105.

Komiya R, Ikegami A, Tamaki S, Yokoi S, Shimamoto K (2008). Hd3a and RFT1 are essential for flowering in rice. Development 135: 767-774.

LaFramboise T, Weir BA, Zhao X, Beroukhim R, Li C, Harrington D, Sellers WR, Meyerson M (2005). Allele-specific amplification in cancer revealed by SNP array analysis. PLos Computational Biology 1: 65.

Lin HX, Yamamoto T, Sasaki T, Yano M (2000). Characterization and detection of epistatic interactions of three QTLs, Hd1, Hd2 and Hd3, controlling heading date in rice using nearly isogenic lines. Theoretical and Applied Genetics 101: 1021-1028.

 Lin SY, Sasaki T, Yano M (1998). Mapping quantitative trait loci controlling seed dormancy and heading date in rice, Oryza sativa L., using backcross inbred lines. Theoretical and Applied Genetics 96: 997–1003.

Liu Q, Sommer SS (2004). Detection of extremely rare alleles by bidirectional pyrophosphorolysis-activated polymerization allele-specific amplification (Bi-PAP-A): measurement of mutation load in mammalian tissues. Bio Techniques 36:156-166.

Lu C, Shen L, Tan Z, Xu Y, He P, Chen Y, Zhu L (1997). Comparative mapping of QTLs for agronomic traits of rice across environments by using a doubled–haploid population. Theoretical and Applied Genetics 94: 145–150.

Maheswaran M, Huang N, Sreerangasamy SR, McCouch SR (2000). Mapping quantitative trait loci associated with days to flowering and photoperiod sensitivity in rice (Oryza sativa L.). Molecular Breeding 6: 145-155.

Nayyeripasand L, Babaeian Jelodar N, NematzadehGA, Ahmadikhah A, Azimi MR (2013). Development of a PCR-based marker for studying allelic variation of Hd3a in rice and its effect on flowering time. International Research Journal of Applied Basic Sciences 4: 402-409.

Ordonez SA, Silva J, Oard JH (2010) Association mapping of grain quality and flowering time in elite japonica rice germplasm. Journal of Cereal Science 51: 337-343.

Park WD (1995). Identification of quantitative trait loci (QTLs) for heading date and plant height in cultivated rice (Oryza sativa L.). Theoretical and Applied Genetics 91: 374–381.

Rabiei B (2007). Linkage map of SSR markers and QTLs detection for heading date of Iranian rice cultivars. Journal of Agricultural Science and Technology 9: 235-242.

Sano Y (1992). Genetic comparisons of chromosome 6 between wild and cultivated rice. Japan Journal of Breeding 42: 561–572.

Semagn K, Bjørnstad A, Ndjiondjop MN (2006). Progress and prospects of marker assisted backcrossing as a tool in crop breeding programs. African Journal of Biotechnology 25: 2588-2603.

Soleimani VD, Baum BR, Johnson DA (2003). Efficient validation of single nucleotide polymorphisms in plants by allele-specific PCR, with an example from barley. Plant Molecular Biology Reporter 21: 281–288.

Tsai KH (1995). Genetic analysis for heading time in wild rice strains. Japan Journal of Genetics 70: 555–562.

Tsuji H, Tamaki S, Komiya R, Shimamoto K (2008). Florigen and the photoperiodic control of flowering in rice. Rice 1: 25-35.

Wang S, Basten CJ, Zeng ZB (2005). Windows QTL Cartographer 2.5. Department of Statistics, North Carolina State University, Raleigh, NC.

Wang J, Chapman SC, Bonnett DG, Rebetzke GJ, Crouch J (2007). Application of population genetic theory and simulation models to efficiently pyramid multiple genes via marker-assisted selection. Crop Science 47: 580–588.

Yamamoto T, Kuboki Y, Lin SY, Sasaki T, Yano M (1998). Fine mapping of quantitative trait loci Hd-1, Hd-2 and Hd-3, controlling heading date of rice, as single Mendelian factors. Theoretical and Applied Genetics 97: 37–44.

Yano M, Harushima Y, Nagamura,Y, Kurata N, Minobe Y, Sasaki T (1997). Identification of quantitative trait loci controlling heading date in rice using a high–density linkage map. Theoretical and Applied Genetics 95: 1025–1032.

Yano M, Katayose Y, Ashikari M, Yamanouchi U, Monna L, Fuse T, Baba T, Yamamoto K, Umehara Y, Nagamura Y, Sasaki T (2000). Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS. Plant Cell 12: 2473-2483.

Yokoo M, Kikuchi F, Nakane A, Fujimaki H (1980). Genetical analysis of heading time by aid of close linkage with blast, Pyricularia oryzae, resistance in rice. Bulletin of National Institute of Agriculture Science 31: 95–126.

Yu SB, Li JX, Xu CG, Tan YF, Li XH, Zhang Q (2002). Identification of quantitative trait loci and epistatic interactions for plant height and heading date in rice. Theoretical and Applied Genetics 104: 619–625.

Yu-long X, Chuan-yuan Y, Jian-guo L, Ma-zhong L, Lin J, Jian-min W (2009). Genetic mechanism of dominant earliness in Kefeng A, a new rice cytoplasmic male sterile line. Rice Science 16: 267–273.

Zhou Y, Li W, Wu W, Chen Q, Mao D, Worland AJ (2001). Genetic dissection of heading time and its components in rice. Theoretical and Applied Genetics 102: 1236-1242.

 


Study of the effect of Hd1-harboring genomic region on heading date in rice

 

Ahmadikhah A.1*, Nayyeripasand L.2

 

1 Departmant of Biotechnology, Faculty of Energy Engineering and Modern Technologies, Shahid Beheshti University, Tehran, Iran.

2 M.Sc. graduate, Department of Plant Breeding and Biotechnology, Sari Agriculturual Sciences and Natural Resources University, Sari, Iran.

 

Abstract

Transition from vegetative to reproductive stage in rice plays a vital role in regulation of timing of flowering and is one of its adaptation related traits to different cultivation areas or different cropping seasons. Several genes related to heading date were identified in rice, that Hd1 on the 6th rice chromosome is one of the most important ones. In this study, two rice cultivars including Sadri (as early flowering donor parent) and Neda (as late flowering recipient parent) were crossed to investigate the effect of Hd1-harboring genomic region on rice heading date, and BC2 generation was developed with two times of backcrossing. Then a single heterozygote plant in BC2 generation was self-pollinated to obtain BC2F2 population for conducting phenotypic and molecular studies. The studied population had a continuous phenotypic distribution in heading date and some individuals in the population showed transgressive segregation over late flowering parent. On the basis of an InDel region in first exon of Hd1 gene a functional specific marker was designed which produced a distinct different banding pattern among the cross parents. Hence, this marker was used to evaluate allelic pattern of Hd1 in BC2F2 population. Analysis of allelic segregation revealed that Hd1 locus in the studied population followed from the expected Mendelian segregation (with 1:2:1 ratios). Composite interval mapping (CIM) with microsatellite markers showed that genomic region at Hd1-RM527 interval had a high relationship (LOD>7.5) to heading date and explained nearly 28 percent of phenotypic variation of the trait. Additive effect of the donor parent allele on the trait was negative and was estimated nearly -3.4 days. Results of this investigation indicated that Hd1 had a significant effect on heading date in rice and it is possible to use the newly developed functional marker in this research for tracing the Hd1 in segregating populations and marker-assisted selection (MAS) for early maturity.

Key words: Early maturity, Functional marker, Mapping.

 

 



* نویسنده مسئول: اسدالله احمدی خواه                تلفن: 09112734072                        Email: ahmadikhaha@gmail.com

[1] Ortholog

[2] Zinc-finger domain

[3] Marker-assisted selection

[4] Marker-assisted backcrossing

[5] Background selection

[6] Recurrent parent genome

[7] Permutation test

[8] Allele-specific amplification

[9] Association studies

* Corresponding Author: Ahmadikhah A.                 Tel: 09112734072            Email: ahmadikhaha@gmail.com

Ahmadikhah A (2009). A rapid mini-prep DNA extraction method in rice. African Journal of Biotechnology 8: 234-238.

Ahmadikhah A (2011). Advanced plant breeding. Gorgan University Press, Goragan, Iran. 480 pp.

Ahmadikhah A, Arkhy A, Ghafari H (2010). Development of an allele specific amplification (ASA) co-dominant marker for fragrance genotyping of rice cultivars. Archives of Applied Science Research 2: 204-211.
Ahmadikhah A, Irannejad A (2010). Development of a co-dominant CMS-specific ALP marker in Tobacco (Nicotiana tabacum). Annals of. Biological Research 1: 101-106.
Brondani C, Rangel PHN, Brondani RPV, Ferreira ME (2002). QTL mapping and introgression of yield–related traits from Oryza glumaepatula to cultivated rice (Oryza sativa) using microsatellite markers. Theoretical and Applied Genetics 104: 1192–1203.
Doi K, Izawa T, Fuse T, Yamanouchi U, Kubo T, Shimatani Z, Yano M, Yoshimura A (2004). Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes and Development 18: 926-936.
Fan CC, Yu XQ, Xing YZ, Xu CG, Luo LJ, Zhang Q (2005). The main effects, epistatic effects and environmental interactions of QTLs on the cooking and eating quality of rice in a doubled-haploid population. Theoretical and Applied Genetics 110: 1445-1452.
Gaafar RM (2010). Molecular marker analysis of heading date Hd1 locus in Egyptian rice varieties. Biotechnology 23: 3368-3372.
Goff SA, Ricke D, Lan TH, Presting G, Wang RL, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, Hadley D, Hutchinson D, Martin C, Katagiri F, Lange BM, Moughamer T, Xia Y, Budworth P, Zhong JP, Miguel T, Paszkowski U, Zhang SP, Colbert M, Sun WL, Chen LL, Cooper B, Park S, Wood TC, Mao L, Quail P, Wing R, Dean R, Yu YS, Zharkikh A, Shen R, Sahasrabudhe S, Thomas A, Cannings R, Gutin A, Pruss D, Reid J, Tavtigian S, Mitchell J, Eldredge G, Scholl T, Miller RM, Bhatnagar S, Adey N, Rubano T, Tusneem N, Robinson R, Feldhaus J, Macalma T, Oliphant A, Briggs S (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. Japonica). Science 296: 92-100.
Hirotsu N, Murakami N, Kashiwagi T, Ujiie K, Ishimaru K (2010). A simple gel-free method for SNP genotyping using allele-specific primers in rice and other plant species. Plant Methods 6: 12-16.
Hayama R, Yokoi S, Tamaki S, Yano M, Shimamoto K (2003). Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 422: 719-722.
Hittalmani S, Shashidhar HE, Bagali PG, Huang N, Sidhu JS, Singh VP, Khush GS (2002). Molecular mapping of quantitative trait loci for plant growth, yield and yield related traits across three diverse locations in a doubled haploid rice population. Euphytica 125: 207–214.
Hospital F, Chevalet C, Mulsant P (1992). Using Markers in Gene Introgression Breeding Programs. Genetics 132: 1199-1210.
Hospital F (2009). Challenges for effective marker-assisted selection in plants. Genetica 136: 303–310.
Kiani Gh (2011). Marker aided selection for aroma in F2 populations of rice. African Journal of Biotechnology 10: 15845-15848.
Kim SL, Lee S, Kim HJ, Nam HG, An G (2007). OsMADS51 is a shortday flowering promoter that functions upstream of Ehd1, OsMADS14, and Hd3a. Plant Physiology 145: 1484-1494.
Kinnear PR, Colin DG (2000). SPSS for Windows made simple: Release 10. Hove, UK: Psychology Press.
Kojima S, Takahashi Y, Kobayashi Y, Monna L, Sasaki T, Araki T, Yano M (2002). Hd3a, a rice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions. Plant Cell Physiology 43: 1096-1105.
Komiya R, Ikegami A, Tamaki S, Yokoi S, Shimamoto K (2008). Hd3a and RFT1 are essential for flowering in rice. Development 135: 767-774.
LaFramboise T, Weir BA, Zhao X, Beroukhim R, Li C, Harrington D, Sellers WR, Meyerson M (2005). Allele-specific amplification in cancer revealed by SNP array analysis. PLos Computational Biology 1: 65.
Lin HX, Yamamoto T, Sasaki T, Yano M (2000). Characterization and detection of epistatic interactions of three QTLs, Hd1, Hd2 and Hd3, controlling heading date in rice using nearly isogenic lines. Theoretical and Applied Genetics 101: 1021-1028.
 Lin SY, Sasaki T, Yano M (1998). Mapping quantitative trait loci controlling seed dormancy and heading date in rice, Oryza sativa L., using backcross inbred lines. Theoretical and Applied Genetics 96: 997–1003.
Liu Q, Sommer SS (2004). Detection of extremely rare alleles by bidirectional pyrophosphorolysis-activated polymerization allele-specific amplification (Bi-PAP-A): measurement of mutation load in mammalian tissues. Bio Techniques 36:156-166.
Lu C, Shen L, Tan Z, Xu Y, He P, Chen Y, Zhu L (1997). Comparative mapping of QTLs for agronomic traits of rice across environments by using a doubled–haploid population. Theoretical and Applied Genetics 94: 145–150.
Maheswaran M, Huang N, Sreerangasamy SR, McCouch SR (2000). Mapping quantitative trait loci associated with days to flowering and photoperiod sensitivity in rice (Oryza sativa L.). Molecular Breeding 6: 145-155.
Nayyeripasand L, Babaeian Jelodar N, NematzadehGA, Ahmadikhah A, Azimi MR (2013). Development of a PCR-based marker for studying allelic variation of Hd3a in rice and its effect on flowering time. International Research Journal of Applied Basic Sciences 4: 402-409.
Ordonez SA, Silva J, Oard JH (2010) Association mapping of grain quality and flowering time in elite japonica rice germplasm. Journal of Cereal Science 51: 337-343.
Park WD (1995). Identification of quantitative trait loci (QTLs) for heading date and plant height in cultivated rice (Oryza sativa L.). Theoretical and Applied Genetics 91: 374–381.
Rabiei B (2007). Linkage map of SSR markers and QTLs detection for heading date of Iranian rice cultivars. Journal of Agricultural Science and Technology 9: 235-242.
Sano Y (1992). Genetic comparisons of chromosome 6 between wild and cultivated rice. Japan Journal of Breeding 42: 561–572.
Semagn K, Bjørnstad A, Ndjiondjop MN (2006). Progress and prospects of marker assisted backcrossing as a tool in crop breeding programs. African Journal of Biotechnology 25: 2588-2603.
Soleimani VD, Baum BR, Johnson DA (2003). Efficient validation of single nucleotide polymorphisms in plants by allele-specific PCR, with an example from barley. Plant Molecular Biology Reporter 21: 281–288.
Tsai KH (1995). Genetic analysis for heading time in wild rice strains. Japan Journal of Genetics 70: 555–562.
Tsuji H, Tamaki S, Komiya R, Shimamoto K (2008). Florigen and the photoperiodic control of flowering in rice. Rice 1: 25-35.
Wang S, Basten CJ, Zeng ZB (2005). Windows QTL Cartographer 2.5. Department of Statistics, North Carolina State University, Raleigh, NC.
Wang J, Chapman SC, Bonnett DG, Rebetzke GJ, Crouch J (2007). Application of population genetic theory and simulation models to efficiently pyramid multiple genes via marker-assisted selection. Crop Science 47: 580–588.
Yamamoto T, Kuboki Y, Lin SY, Sasaki T, Yano M (1998). Fine mapping of quantitative trait loci Hd-1, Hd-2 and Hd-3, controlling heading date of rice, as single Mendelian factors. Theoretical and Applied Genetics 97: 37–44.
Yano M, Harushima Y, Nagamura,Y, Kurata N, Minobe Y, Sasaki T (1997). Identification of quantitative trait loci controlling heading date in rice using a high–density linkage map. Theoretical and Applied Genetics 95: 1025–1032.
Yano M, Katayose Y, Ashikari M, Yamanouchi U, Monna L, Fuse T, Baba T, Yamamoto K, Umehara Y, Nagamura Y, Sasaki T (2000). Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS. Plant Cell 12: 2473-2483.
Yokoo M, Kikuchi F, Nakane A, Fujimaki H (1980). Genetical analysis of heading time by aid of close linkage with blast, Pyricularia oryzae, resistance in rice. Bulletin of National Institute of Agriculture Science 31: 95–126.
Yu SB, Li JX, Xu CG, Tan YF, Li XH, Zhang Q (2002). Identification of quantitative trait loci and epistatic interactions for plant height and heading date in rice. Theoretical and Applied Genetics 104: 619–625.
Yu-long X, Chuan-yuan Y, Jian-guo L, Ma-zhong L, Lin J, Jian-min W (2009). Genetic mechanism of dominant earliness in Kefeng A, a new rice cytoplasmic male sterile line. Rice Science 16: 267–273.
Zhou Y, Li W, Wu W, Chen Q, Mao D, Worland AJ (2001). Genetic dissection of heading time and its components in rice. Theoretical and Applied Genetics 102: 1236-1242.