راهنمای نویسندگان

 لینک راهنمای تدوین مقالات***

مقالات خارج از فرمت و دستورالعمل لینک بالا ، رد خواهند شد.

راهنمای نگارش و تدوین مقالات مجله بیوتکنولوژی کشاورزی

 

عنوان مقاله با فونت فارسی بی میترا تیره 14  (B Mitra, 14 Bold) و کلمات انگلیسی آن Times New Roman, 14 Bold

 

 (اسامی نویسندگان را به هیچ وجه درج نکنید)

"مجله بیوتکنولوژی کشاورزی" (Agricultural Biotechnology Journal) مقالات علمی- پژوهشی را به شکل مقاله، مقاله کوتاه و مقاله مروری (به دعوت هیأت تحریریه از متخصصین و صاحبنظران) که حاصل تحقیقات در زمینه های بیوتکنولوژی کشاورزی (اعم از گیاهی، دام و طیور، آبزیان و در رابطه با کشت بافت، مهندسی ژنتیک، نشانگرها و...) باشند منتشر می کند. مقالات ارسالی نباید در هیچ مجله یا نشریه‌ای چاپ شده و یا همزمان به مجله دیگری ارسال شده باشند. زبان اصلی مجله فارسی است، مسئولیت صحت علمی مطالب درج شده در مقاله بر عهده نویسنده مسئول مکاتبات (Corresponding Author) در درجه اول و سایر نویسنده(گان) در درجه بعدی است. رعایت کلیه جوانب حقوقی مقاله بر عهده نویسنده مسئول مکاتبات می‌باشد. هیأت تحریریه در پذیرش و یا رد مقالات ارسالی طبق ضوابط مجله مخیر هستند. مقاله باید با نرم افزار Word و با پسوند doc آماده شود. نام فایل مقاله باید با حروف انگلیسی و فامیل نویسنده مسئول مکاتبات باشد و از طریق سایت مجله (http://jab.uk.ac..ir) ارسال شود. تأییدیه دریافت مقاله به طور خودکار از طریق سیستم به نویسنده مسئول ارسال خواهد می‌شود.

 

چکیده فارسی (B Mitra, 14 Bold) (Times New Roman, 11 Bold)

چکیده فارسی مقاله باید ساختار یافته بوده (مبسوط) و شامل بخش‏های هدف، روش، یافته‏ها و نتیجه‏گیری باشد. یادآوری می‎شود که تمام این بخش‎ها در خط جداگانه‎ای نوشته می‎شوند. چکیده مقاله، نباید کمتر از 200 کلمه و بیشتر از 300 کلمه باشد. باید از اشاره به مراجع و استفاده از پاورقی در چکیده خودداری شود. چکیده مقاله باید با قلم فارسی BMitra اندازه pt. 12، با فاصله خطوط 5/1، فاصله 3 سانتی‎متر از سمت راست و چپ و 3 سانتی‎متر از بالا و پایین کاغذ، با کناره­های ردیف شده (Justify Low) نوشته شود و به صورت دقیق در نمونه فرمت چکیده فارسی که در قسمت راهنمای نویسندگان نشریه آمده است، جای بگیرد. چکیده های خارج از این فرمت پذیرفته نمی‎شوند.

کلیدواژه‏ها باید حداقل 3 و حداکثر 5 واژه بوده که با کاما (،) از هم جدا شده و در یک خط و به ‎ترتیب حروف الفبا با قلم فارسی (12 BMitra) باشند.

مقدمه (B Mitra, 12 Bold) (Times New Roman, 11 Bold)

به ‌منظور یکسان‌‎سازی مجموعه مقاله‌ها و نیز برای آنکه امکان ترکیب و انتقال فایل رایانه‌ای آن‏ها فراهم شود، لازم است که همۀ مقاله‌ها با طرحی یکسان، کامل و هماهنگ تهیه و تایپ شوند. این راهنما به نویسندگان مقاله‌ها کمک می‌کند تا مقالۀ خود را با طرح مورد قبول مجله بیوتکنولوژی کشاورزی تهیه کنند. برای تایپ مقاله به زبان فارسی، فقط از نرم‎افزار مایکروسافت ورد نسخۀ 2003 (MS-Word 2003) در محیط ویندوز با امکانات فارسی استفاده کنید. حروف‎چینی مقاله باید با رعایت  فاصله خطوط 5/1، فاصله 3 سانتیمتر از سمت راست و چپ و فاصله 3 سانتیمتر از بالا و پایین کاغذ باشد.

متن اصلی مقاله به ‎صورت تک‎ستونی با قلم (فونت) B Mitra و اندازۀ pt. 12 و قلم انگلیسی Times New Roman با اندازۀ pt. 11 تهیه شود. عنوان همۀ بخش‌ها با قلم  B Mitra, 12 Boldتایپ شوند. عنوان هر بخش یا زیربخش، با یک خط خالی فاصله از انتهای متن بخش قبلی تایپ شود. در متن مقاله از شماره‌‎گذاری عنوان‎‌ها خودداری نمایید. خط اول همۀ پاراگراف‌ها با یک تورفتگی (1 سانتی متری) و پاراگراف‎‌های بعدی بدون تورفتگی خواهد بود (لطفاً پیش از آغاز کار، نخست فونت‎‌های ارائه شده را نصب نمایید).

 

ترتیب سرفصل‎‌های مقاله (بسیار مهم)

مقاله شامل: عنوان، چکیده فارسی، واژه های کلیدی فارسی، مقدمه، مواد و روش‌ها، نتایج و بحث، نتیجه گیری، سپاسگزاری، منابع، References چکیده انگلیسی و واژه های کلیدی انگلیسی است.

ترتیب عنوان‎های مقاله به‌ طور دقیق شامل این تیترها باشد: مقدمه، مواد و روش‌­ها، نتایج و بحث، نتیجه­‌گیری، سپاسگزاری، منابع، References.

مقدمه: شامل بیان مسئله، پیشینه پژوهش، تشریح اهمیت تحقیق و هدف از انجام تحقیق به طور شفاف، مفید و مختصر باشد.

مواد و روش­‌ها: دربرگیرنده مواد مورد استفاده، وسایل کار، طرح و روش تجزیه آماری، شیوه جمع آوری داده ها و نحوه اجرای پژوهش به صورت مشخص و روشن باشد. محل انجام آزمایش، نوع و مشخصات دستگاه‌های مورد استفاده و مواد شیمیایی (با ذکر نام محل تولید آنها) ذکر شود.

نتایج و بحث: نتایج شامل خلاصه‌ای از یافته‌های علمی بدست آمده از تحقیق، بحث مستدل به صورت مقایسه نتایج تحقیق با یافته های دیگران در این رابطه و نتیجه گیری می باشد. شکل ها و جداول در نتایج و بحث نباید دارای اطلاعات مشابه یا تکراری باشند و اعداد جداول نباید مجدداً به صورت منحنی یا نمودار (به استثنای نقشه) تکرار شوند. هیچ یک از جداول و شکل­‌ها نباید در صفحه افقی بیایند (به صورت افقی نباشند). لازم است ترجمه انگلیسی عنوان‌های جداول و شکل‌ها و متن داخل جداول در زیر نوشته‌ی فارسی آن‌ها درج شود و اعداد جداول نیز فقط انگلیسی آورده شوند.

سپاسگزاری از افراد یا مؤسساتی که به نحوی در انجام تحقیق مشارکت داشته اند در صورت نیاز قبل از منابع آورده شود.

 

فایل‌های ارسالی به ادارۀ انتشارات از طریق سامانۀ دریافت مقاله‌‎ها

چهار فایل ضروری که باید از طریق سامانۀ دریافت مقاله‌ها ارسال شوند. 1. فایل اصلی مقاله (بدون نام نویسندگان)، 2. فایل مشخصات نویسندگان با فرمت یاد شده؛ 3.  فرم تعهدنامه (باید شامل عنوان مقاله و نام و نام خانوادگی تمام نویسندگان باشد و به امضای همه نویسندگان رسیده باشد)؛ و 4. فرم تضاد منافع (باید توسط نویسنده مسئول امضاء و به همراه فایل مقاله بارگذاری شود).

در ارسال فایل مشخصات نویسندگان به این موارد دقت کنید: 1. نام و نام خانوادگی نویسندگان به ‎طور کامل نوشته شود (لطفا در بخش انگلیسی مشخصات، املای نام نویسندگان پس از تأیید نویسنده درج شود)؛ 2. ایمیل و شماره تماس تمام نویسندگان نوشته شود؛ 3. مراتب علمی تمام نویسندگان به ‎طور کامل نوشته شود (لطفاً).

 

حداکثر تعداد صفحات مقاله

حداکثر تعداد صفحات مقاله (شامل کلیه بخش‎‌های مقاله، اعم از چکیده انگلیسی و فارسی و منابع و...) که منطبق با این راهنما تدوین تهیه می‌شود، نباید از 20 صفحه در همین فرمت بیشتر باشد. 

واژه‌های خارجی در متن فارسی

برای واژه‌ها و نام‌های خارجی، در حد امکان از معادل‌های فارسی مصطلح و مصوب استفاده کنید. می‏توانید از بانک مستندات کتابخانه ملی ایران برای مستندسازی نام خانوادگی افراد استفاده کنید. در خصوص نام‌های خارجی ضروری و غیرمتداول یا معادل‌های غیرمصطلح فارسی فقط در اولین ارجاع و در اولین حضور در متن و بلافاصله پس از بیان این‎‌گونه واژه‌ها، معادل لاتین آن را به‎ صورت زیرنویس (پاورقی) در پایین همان صفحه قید نمایید.

در صورت نیاز به درج زیرنویس، همۀ‌ موارد فارسی به‎ صورت راست‌چین با قلم BMitra و اندازۀ pt. 11[1] و زیرنویس‌‏های لاتین به صورت چپ‌چین با قلم Times New Roman اندازۀ pt. 10[2] نوشته شوند. در پانویس بعد از شماره یک نقطه، سپس یک فاصله و بعد معادل فارسی یا انگلیسی را تایپ کنید.

 

معرفی نشانه و متغیرها در متن

باید هر نوع متغیر یا علامت به ‎کار رفته در متن مقاله، در اولین ارجاع در خود متن مقاله معرفی شود.

 

شکل‎‌ها

هر شکل اعم از نمودار، چارت، نقشه و... باید به ‎صورت وسط‌‏چین  در زیر آن با قلم B Mitra پررنگ و اندازۀ  pt. 12 تایپ و به ‎ترتیب از 1 (شکل 1، شکل 2، ...) شماره‌گذاری ‌شوند. نمودارها می‎‌توانند به‎ صورت رنگی یا سیاه و سفید باشند؛ اما به ‎گونه‌‏ای که در صورت چاپ سیاه و سفید رنگ‏‌ها و جزئیات آن‏ها قابل تشخیص باشد. نمودارها و شکل‏‌ها در داخل متن و در جایی درج شوند که به آن‏ها ارجاع می‌شود. بیان واحد کمیت‌ها در نمودارها به زبان فارسی الزامی است. در متن مقاله باید به همۀ نمودارها ارجاع شود و مختصر توضیح داده شوند. در تهیۀ نمودارها توجه کنید که اندازۀ اعداد، واژه‌ها، کمیت‌ها و راهنمای منحنی‌ها (Legend) به قدر کافی بزرگ باشد تا پس از درج در مقاله، کاملاً واضح و خوانا باشند. دقت نمایید که اگر نمودار داخل مقاله به ‎شکل تصویر (خروجی نرم‎افزار) است، باید وضوح کامل داشته باشد. بهتر است فایل اصلی نمودارها در متن مقاله قرار داده شود. هر نمودار را با یک سطر خالی فاصله از متن ماقبل و مابعد آن قرار دهید. یک نمونه نمودار در زیر آمده است. توجه شود که خود نمودارها نیز، همانند جدول­‌ها باید در موقعیت وسط‎چین نسبت به دو طرف کاغذ قرار گیرند.

 

شکل 1. نموداری برای نمونه (B Mitra، 12 پررنگ)

Figure 1. A diagram for example (Times New Roman, 11 Bold)

 

شکل 2. منحنی ذوب محصول ژن لپتین و بتااکتین حاصل از واکنش Real Time PCR برای گوسفند کرمانی (B Mitra، 12 پررنگ)

Figure 2. Melting curve of leptin and beta actin gene production using Real Time PCR for Kermani sheep (Times New Roman, 11 Bold)

 

 

شکل 3. الکتروفورز نمونه های مورد بررسی با استفاده از پرایمرهای لپتین در گوسفند کرمانی روی ژل آگارز. M50؛ نشانگر اندازه. چاهک­‌های 2، 3، 4، 6 و 7 به ترتیب مربوط به بافت چربی، جگر، کلیه، شش و قلب هستند (B Mitra، 12 پررنگ)

Figure 3. Electrophoresis of studied samples using leptin primers in Kermani sheep on agarose gel. M50; size marker. Lanes 2, 3, 4, 6 and 7 present adipose tissue, liver, kidney, lung and heart, respectively (Times New Roman, 11 Bold)


جدول‌ها

لازم است ترجمه انگلیسی عنوان‌های جداول و شکل‌ها و متن داخل جداول در زیر نوشته‌ی فارسی آن‌ها درج شود و اعداد جداول نیز فقط انگلیسی آورده شوند. نوشته های فارسی داخل جدول باید B Mitra، 11 و اعداد و نوشته های انگلیسی داخل جدول باید Times New Roman, 10 باشند. مانند نمونه زیر:

 

جدول 1. توالی آغازگرهای استفاده شده برای بیان ژن لپتین با شماره دسترسی GU944974  در بافت‌­های مختلف گوسفند کرمانی (B Mitra، 12 پررنگ)

Table 1. Oligonucleotide primer pairs used for leptin gene expression in different tissues of Kermani sheep with accession no. GU944974 (Times New Roman, 11 Bold)

طول قطعه تکثیر شده

Amplicon size (bp)

 

توالی آغازگر

Primer sequence

نام ژن

Gene name

 

199

5'-GCCTATGTGGGCATCCTTTA-3'

آغازگر رفت

Sense Primer

ژن leptin

 leptin gene

5'-TGGAACAGGGAGGAAGACTG -3′

آغازگر برگشت

Antisense Primer

 

 

200

5'- ACCACTGGCATTGTCATGGACTCT -3'

آغازگر رفت

Sense Primer

ژن بتااکتین

Beta actin Gene

5'- TCCTTGATGTCACGGACGATTTCC -3'

آغازگر برگشت

Antisense Primer

 

 

فایل هر شکل، با پسوند JPG و با کیفیت حداقل dpi300 باید در متن مقاله آورده شود (علاوه بر متن می توانید هر شکل را به صورت یک فایل جداگانه در سایت مجله، هنگام ارسال مقاله نیز بارگذاری کنید). برای چاپ ممکن است شکل ها کوچکتر شوند، لذا نوشته ها و اعداد روی شکل ها درشت و کاملاً خوانا باشند. عکس ها باید دارای مقیاس باشند و در صورت اقتباس از منبع دیگر به آن اشاره شود.

اسامی علمی باید در تمام مقاله با حروف ایتالیک تایپ شوند. عنوان جدول در بالا و عنوان شکل در زیر آن نوشته شود. از عنوان هایی مثل نمودار، عکس و نقشه استفاده نشوند و فقط از کلمه شکل استفاده گردد. همه اعداد، واحدها و مقیاس ها در تمام قسمت های مقاله به فارسی و بر مبنای واحدهای سیستم متریک استفاده گردد. از ذکر کلمه "شماره" بعد از جدول یا شکل خودداری شود.

 

فرمول‌ها و روابط ریاضی

برای نمایش روابط و فرمول‏‌های ریاضی از جدول دو ستونی با خطوط نامرئی مطابق نمونه زیر استفاده شود. در ستون سمت راست این جدول، شماره رابطه و در ستون سمت چپ رابطه یا فرمول مربوط نوشته شود. استفاده از Microsoft Equation در نوشتن فرمول‌‏ها الزامی است. تمام روابط ریاضی به ‎ترتیب از 1 شماره‌گذاری شوند و شمارۀ هر رابطه با پرانتز جدا می‎شود. روابط باید با اندازه فونت 11 و قلم Cambria Math باشد. دو نمونه فرمول در زیر آمده است.

رابطه‎ 1)

 

رابطه‎ 2)

 

نتیجه‌‏گیری

بخش جمع‌بندی و نتیجه‌گیری پس از متن اصلی مقاله الزامی است. در صورت داشتن پیشنهادهای برخاسته از پژوهش، می‌‎توانید آن‏ها را در انتهای نتیجه‌‎گیری قرار دهید.

 

روش مأخذنویسی

برای منبع‌‎دهی از روش استاندارد Veterinary Anaesthesia and Analgesia استفاده کنید. می‎‌توان برای افزایش بهره‎‌وری و راحتی در این ‎کار از نرم ­افزار Word یا Endnote استفاده کرد. برای دانلود سبک اندنوت (EndNote style) از لینک زیر می‌­توانید استفاده کنید:

https://endnote.com/style_download/veterinary-anaesthesia-and-analgesia/

‎ منابع مورد استفاده باید شامل فهرست تمام منابع باشد که همگی به‌ترتیب حروف الفبا تنظیم شده باشند. نحوه ارجاع به منابع در متن به‌صورت اسم نویسنده(گان) و تاریخ انتشار منبع باشد. حتی‌الامکان از نام بردن افراد در شروع جمله خودداری گردد و منابع در انتهای جمله و در پرانتز ارائه شوند، مانند (Mohammadabadi 2017). برای جداسازی منابع در انتهای جمله از ";" استفاده شود مانند (Smith 1999; Samuel et al. 2008; Smith & Samuel 2009). چنانچه در شروع جمله به منبعی استناد شود به صورت نام (سال) نوشته شود و اسامی فارسی نیز باید به لاتین و سال شمسی به میلادی برگردان شوند. اگر بیشتر از یک منبع در سال از یک نویسنده وجود داشته باشد باید با حروف a و b و ... مشخص شوند. مانند (Williams et al. 2016a) و (Jones et al. 2016a,b). در ادامه نمونه هایی از منابع مختلف مشخص شده است:

 

مجله (Journal)

با 1 نویسنده

Mohammadabadi MR (2017) Role of clostridium perfringens in pathogenicity of some domestic animals. J Adv Agric 7, 1117-1121.

با 2 نویسنده

Argraves WS, Suzuki S (1987) Amino acid sequence of the human fibronectin receptor. J Cell Biol 105, 1183-1190.

با 4 نویسنده

Andrade C, Sandarsh S, Chethan KB, Nagesh KS (2010) Serotonin reuptake inhibitor antidepressants and abnormal bleeding: a review for clinicians and a reconsideration of mechanisms. J Clin Psychiatry 71, 1565-1575.

Mohammadabadi MR, Askari N, Baghizadeh A, Esmailizadeh AK (2009) A directed search around caprine candidate loci provided evidence for microsatellites linkage to growth and cashmere yield in Rayini goats. Small Rumin Res 81, 146–151.

با 5 و بیشتر نویسنده

Young LE, Blissitt KJ, Clutton RE et al. (1998) Temporal effects of an infusion of dobutamine hydrochloride in horses anesthetized with halothane. Am J Vet Res 59, 1027-1032.

Campagna I, Schwarz A, Keller S et al. (2015) Comparison of the effects of propofol or alfaxalone for anaesthesia induction and maintenance on respiration in cats. Vet Anaesth Analg 42, 484-492.

با 5 نویسنده و بیشتر که هر دو در یک سال هستند

Larenza MP, Ringer SK, Kutter AP et al. (2009a) Evaluation of anesthesia recovery quality after lowdose racemic or S-ketamine infusions during anesthesia with isoflurane in horses. Am J Vet Res 70, 710-718.

Larenza MP, Peterbauer C, Landoni MF et al. (2009b) Stereoselective pharmacokinetics of ketamine and norketamine after constant rate infusion of a subanesthetic dose of racemic ketamine or Sketamine in Shetland ponies. Am J Vet Res 70, 831-839.


چاپ برخط بدون شماره صفحه قبل از چاپ نهایی

Conde Ruiz C, Del Carro A, Rosset E et al. (2015) Alfaxalone for total intravenous anaesthesia in bitches undergoing elective caesarean section and its effects on puppies: a randomized clinical trial. Vet Anaesth Analg. https://doi.org/10.1111/vaa.12298 [Epub ahead of print].

چاپ برخط بدون شماره صفحه همیشگی

Moher D, Liberati A, Tetzlaff J et al. (2009) Preferred reporting items for systematic reviews and metaanalyses: the PRISMA statement. PLoS Med 6, e1000097.

بی نام

[No authors listed] (2013) Notice of formal retraction of articles by Dr. Y. Fujii. Br J Anaesth 110, 669.

کتاب (Book)

Hall LW, Taylor PM (1994) Anaesthesia of the Cat (1st edn), Balliere Tindall, London, UK, pp. 189-193.

Pascoe PJ, Bennett RC (1999) Thoracic Surgery. In: Manual of Small Animal Anaesthesia and Analgesia (1st edn). Seymour C, Gleed R (eds). BSAVA, UK. pp. 183-196.

 

چکیده (Abstract)

Portela D, Campoy L, Otero P et al. (2015) Ultrasound-guided thoracic paravertebral injection in dog cadavers. Vet Anaesth Analg 42, A55 (abstract).

وب سایت (Web address)

Seeler DC, Turnwald GH, Bull KS (1999) From teaching to learning: Part III. Lectures and approaches to active learning. J Vet Med Educ 21 http://scholar.lib.vt.edu/ejournals/JVME/V21-1/Seeler1.html Last accessed 1 January 2017.

پایان‌نامه (Thesis)

Smith GY (1978) Title of thesis. PhD thesis, University. pp. 97-112.

کنفرانس‌علمی (Scientific conference):

Zamiri MJ, Heidari AH (2004) Reproductive characteristics of Rayini male goats in Kerman province of Iran. Proc. of 11th Congress of the Asian-Australasian Association of Animal Production Societies. Volume II, Sept. 5-9, 2004. Kuala Lumpur, Malaysia. pp. 458-460,

مرجع مخفف سازی نام مجلات (Journal abbreviations source)

نام مجلات باید بر اساس فرم‌­های استاندارد در کتابخانه ملی پزشکی، آمریکا، پایگاه اطلاعاتی MEDLINE  یا PubMed مخفف‌­سازی شوند. همچنین عنوان کتاب­‌ها باید کامل نوشته شود. برای این امر از لینک زیر می­‌توانید استفاده کنید (List of Title Word Abbreviations):

http://www.issn.org/services/online-services/access-to-the-ltwa/

در فهرست منابع انگلیسی بایستی تمام منابع فارسی بر اساس چکیده و مشخصات کتابشناختی انگلیسی هر منبع در مجله‏ای که منتشر شده و با قلم Times New Roman اندازه . pt11 نوشته شده و عنوان کتاب و نام نشریه مشخص شود. از ترجمه منابع فارسی با استفاده از گوگل مترجم اکیداً خودداری شود. به عبارت دیگر، منابع فارسی یک‏بار به زبان فارسی در بخش منابع به ترتیب حروف الفبا نوشته می‎شود و بار دوم به انگلیسی در قسمت منابع لاتین (References) بر اساس حروف الفبا درج شده و در انتهای منبع (in Persian) گذاشته می‎شود.

 

نکات مهم در مورد فهرست منابع فارسی:

  1. در داخل متن کلیه منابع باید به زبان انگلیسی نوشته شوند (حتی منابع فارسی).
  2. منابع فارسی به زبان فارسی در لیست منابع هم نوشته شوند:

نام خانوادگی نویسندۀ اول نام کوچک همان نویسنده؛ نام خانودگی نویسندۀ دوم نام کوچک همان نویسنده (سال انتشار) عنوان مقاله. نام نشریه دوره، صفحه شروع مقاله ـ صفحه پایان مقاله.

تقوا محمدرضا؛ منصوری طاها؛ فیضی کامران؛ اخگر بابک (1395) کشف تقلب در تراکنش‏های کارت‏های بانکی با استفاده از پردازش موازی ناهنجاری در بزرگ‌داده. فصلنامه مدیریت فناوری اطلاعات 8، 498-477.

نکات مهم در مورد فهرست منابع انگلیسی:

  1. در پایان متن در قسمت "References" علاوه بر منابع انگلیسی، منابع فارسی نیز باید به زبان انگلیسی آورده شوند.
  2. برای ترجمه منابع فارسی لطفاً به چکیدۀ انگلیسی مقاله، صفحه عنوان انگلیسی کتاب، صفحه عنوان انگلیسی پایان‏نامه، و... مراجعه کنید یا از مترجم کمک بگیرید. برنامۀ Google Translate پاسخ مناسبی به شما نمی‎دهد.
  3. در انتهای منابعی که فارسی هستند و به انگلیسی ترجمه شده‎ حتماً (in Persian)  اضافه شود.
  4. منابع باید به ترتیب حروف الفبای انگلیسی مرتب شوند.
  5. مطمئن شوید که منابع اشاره شده در متن در مآخذ نوشته شده باشند و برعکس.

English Title of the Article with English Font (Times New Roman) Size 14 Bold, Heading 1. Capitalize all “major” words (nouns, verbs, adjectives, adverbs, and pronouns) in the title and subtitle (:)

 

چکیده انگلیسی مقاله باید ساختاریافته بوده و به ‎‎طور دقیق با ترجمه چکیده فارسی همسان باشد (رعایت تمام دستورالعمل‎های چکیده‌‎نویسی فارسی در این بخش هم الزامی است)، چکیده مقاله، نباید کمتر از 200 کلمه و بیشتر از 250 کلمه باشد. از اشاره به مراجع و استفاده از پاورقی در چکیده خودداری شود. چکیده انگلیسی باید با قلم Times New Roman, 11 با فاصله خطوط 5/1 ، فاصله 3 سانتی‎متر از سمت راست و چپ و 3 سانتی‎متر از بالا و پایین کاغذ،  با کناره­‌های ردیف شده (Justify Low) نوشته شود و به صورت دقیق در نمونه فرمت چکیده انگلیسی که در قسمت راهنمای نویسندگان نشریه آمده است، جای گیرد. در نوشتن عنوان انگلیسی دقت کنید که به جز حروف اضافه تمام کلمات با حرف بزرگ نوشته شوند. چکیده‏‌های خارج از این فرمت پذیرفته نمی‌‎شوند.

کلیدواژه‌های انگلیسی به تعداد کلیدواژه‌های فارسی و ترجمه دقیق همان واژگان با قلم Times New Roman 11باشد و به ترتیب حروف الفبا ذکر شوند.

 

برخی نکات مهم ویرایشی

  1. برای شماره‌­گذاری از عدد و نقطه استفاده شود؛ مانند شماره­‌گذاری همین قسمت.
  2. قبل از نقطه، ویرگول، نقطه ویرگول، دونقطه، علامت سؤال، علامت تعجب و ... نیازی به فاصله (space) نیست؛ اما بعد از این علائم باید یک فاصله گذاشته شود.
  3. هنگام استفاده از پرانتز قبل از باز شدن پرانتز و بعد از بسته شدن پرانتز از فاصله استفاده کنید، کلمه داخل پرانتز بدون فاصله به پرانتز می‎‌چسبد.
  4. برای نوشتن کلمات مرکب یا بعضی افعال و واژگان مشابه از نیم‌­فاصله استفاده شود (برای مثال انسان‎‌ها، می‎‌رود، تصمیم‌‎گیری، اندازه‌‎گیری، بهره‌‎مند، منطق‌ه‎ای، همان‎‌گونه و...) [برای مثال: می‌ خواهم (غلط) می‎‌خواهم (درست)]. برای ایجاد نیم‌­فاصله در نرم‌افزار Word می‎‌توانید از (CTRL + Shift + 2) در حالت صفحه کلید فارسی یا (Shift + Space) یا (CTRL + -) استفاده کنید (بسته به نوع ویندوز یکی از موارد عمل می‎‌کند).
  5. به‎ جای استفاده از علامت (%) در متن از کلمه درصد استفاده کنید. مانند: 5‎ درصد.
  6. از به‎ کار بردن (ه‎ی) و همزه (ۀ) در متن مقاله خودداری کنید.


.[1]  نمونه زیر نویس فارسی با قلم BMitra  و اندازه 11

[2].  Footnote (Times New Roman 10)